The Villain of CRISPR(michaeleisen.org) |
The Villain of CRISPR(michaeleisen.org) |
People need to follow Alexander Flemings lead:
The pharmacist Sir Alexander Fleming is revered not just
because of his discovery of penicillin – the antibiotic
that has saved millions of lives – but also due to his
efforts to ensure that it was freely available to as much
of the world’s population as possible. Fleming could have
become a hugely wealthy man if he had decided to control
and license the substance, but he understood that
penicillin’s potential to overcome diseases such as
syphilis, gangrene and tuberculosis meant it had to be
released into the world to serve the greater good. On the
eve of World War II, he transferred the patents to the US
and UK governments, which were able to mass-produce
penicillin in time to treat many of the wounded in that
war. It has saved many millions of lives since.
http://www.mobileworldlive.com/blog/penicillin-the-antidote-..."When asked who owned the patent to it, Salk said, 'There is no patent. Could you patent the sun?'"
But enabling technologies (like CRSPR) get licensed non-exclusively, particularly when the patent holder is an academic institution. If the patents around CRSPR are licensed non-exclusively, at reasonably prices, and with appropriate treatment for academic researchers, these patents aren't going to slow science down.
A good example is the original polymerase chain reaction patents, which were held by Cetus. Despite lots of legal arguments, PCR was always widely available.
Here's a nice analysis of the PCR patent situation and its effects on technology diffusion: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1523369/
As Eisen points out its kind of odd that the group who rush to do the obvious human implementation should then get a share of all this potential... Not really a novel invention by that point in my opinion.
I generally agree that discoveries like this should go in the public domain as quickly as possible.
The pissing contest about "who invented what, when" is fine and good, to a point; nobody cares if "Cancer Immunity 1.0" drug has a tagline "brought to you by Lander's Finest". To the extent that success and notoriety determine careers, and so we should "get it right" so that the "right" people get credit... I think most researchers will persevere and continue to do science (for the benefit of humanity or for personal glory, or whatever) even if they get shafted for credit.
But the technology itself.. get it into everybody's hands and let the thousand flowers bloom already.
This is a problematic phrase: https://en.wikipedia.org/wiki/Hundred_Flowers_Campaign
If people have a right to own secrets, and if NDAs can be legally enforced, then a market of (the knowledge of) facts can naturally emerge that's strictly worse than the patent system.
The people that need to change this are at the administrative level: laws via congress, and then chancellors of universities.
[1] http://www.fda.gov/Drugs/DevelopmentApprovalProcess/SmallBus...
regarding costs of governmental approval: they are a problem. the government will need to use our tax money for this sort of activity rather than shiny new weapons, I suppose. Their fees are absurd. Approval of a specific substance as a treatment for illness ought to be borne by the same public sector that owns it in my common-sensical world i suppose...
My own position is that in a sane world, there would be no patent and the groups would share the Nobel. The patent ownership dispute is the only reason there has to be a fight at all, and while patents on techniques in biology aren't nearly as absurd and destructive over patents on software, I think they're almost certainly net negative overall.
I know it's not valid reasoning but it would be almost certainly right in software. I'm pretty sure software patents are poisoning the whole patent system both from the inside and in public opinion.
and friend and colleague of Jennifer Doudna.
What’s the path forward? Is labeling Lander a “villain” useful?
It's a very provocative title, but the policy recommendation in the article—that we stop issuing Nobel prizes and patents to individuals when discoveries happened over a long process—is pretty fair. And he does credit Lander for acknowledging all the scientists that predated both of their universities' work.
Whether any of this is useful in a broader sense is unclear, but we are almost certainly seeing the most important story in history of biology for this generation unfolding before us.
However, it's also clear that Doudna's work was central and a hub for overall advancement.
CRISPR is just one tiny replaceable part of any therapy-driving genome editing technique. The frenzy around it overstates its importance.
Cas9 is significant as the first RNA-guided nuclease that we learned how to manipulate, but there are probably many more in nature. Hopefully we will be able to construct our own in short order.
We have had very high quality programmable nucleases for a long time. Nucleases are not the principal expense in genome engineering. Further, if you want to be sure that the cuts you make are correct and on-target you might want to take the time to use another system than Cas9/tracRNA.
However, dCas9 (disabled Cas'es) and friends are amazingly novel, in that they allow us to make huge libraries of targeted DNA binding complexes that don't cut DNA, but let us pull particular things to particular places in the genome. This is an incredible boon to certain research threads. For example, see http://www.sciencedirect.com/science/article/pii/S0092867413...
At first I thought it was an honest mistake, but now it would not surprise me if some of the main players know that their experiments with CRISPR have been misinterpreted. They are then pushing the gene "modification" label anyway because it is sexier.
After all, CRISPR has received an extremely unusual amount of media coverage over the last year or so, which raises red flags. I suspect a marketing effort is being directly funded. That is not a honest use of funds meant for research, especially that which is not meeting minimum scientific standards (ruling out other explanations for the results rather than just a null hypothesis).
[1] https://en.wikipedia.org/wiki/Leibniz%E2%80%93Newton_calculu...
[2] https://en.wikipedia.org/wiki/Rosalind_Franklin#Contribution...
However, it's far more pure, than, say, typical SV venture capital.
Lander is widely known for being both a scientific and political heavyweight. He knows how to gain power, knows how to wield it, and uses it both to serve scientific goals and his own.
Such use of power has pushed forward science to some degree by allowing considerable economic resources to be applied in a focused manner. But it gets used for other purposes too, because Lander is still a human, and still makes mistakes.
If you are Eric Lander, you've already tuned the Broad Institute towards what you expect to be the most fruitful paths of research to improve humankind, and the best way to have it improve humankind is more funding. Michael Eisen might have different opinions on the best paths of research, and you probably have some things you think will pay off that he doesn't, or he thinks will pay off that you don't. It is entirely rational to look at the amount of money available to fund research from public sources and the amount available from private industry, and determine that the best way to save the world is to get that patent and license it aggressively.
And, if you're Michael Eisen, you know that your colleagues are doing excellent work and only one person can own the patent, and that patent going to the Broad represents a significant loss to your colleagues' potential funding, so it's entirely rational to decide the best way to save the world is to contest the patent aggressively.
If we, the onlookers, want to fix this, we need to fix the funding problem. I rather doubt that either Lander or Eisen were driven by desires of patent ownership or denying other people patent ownership when they originally entered the field.
It depends on the initial number of cells, initial proportion of mutants, division rates, and toxicity. I have also noted that the initial number of cells is usually reported without any uncertainty, which makes me think those numbers may be rather unreliable.
I've seen plenty of people and papers where dna was edited in across entirely different organism realms, bacteria dna in animals, animal dna in plants, and so on...
I honestly don't understand how the technique ins't about editing, the only use I saw for it is editing.
EDIT: I asked my sister to give me links to some papers, I will post them after she replies.
"Although rare (∼1–2%), edits were detected with Cas9-only control treatment, including at the predicted CXCR4 cut site, potentially indicating trace amounts of experimental contamination of the Cas9 RNPs." http://www.pnas.org/content/112/33/10437.full
Note the curiously missing rows in dataset S1.
Unless I'm misunderstanding something about how the experiments are done, your theory would require many groups to be independently committing scientific fraud, which is very implausible.
Staying with Schuman et al (2015) linked in this thread, they start with 2.5 x 10^5 cells and end up with 5 x 10^4 to 2 x 10^5 three to four days later. Why are there fewer cells even without accounting for any division? Because the treatment is toxic. This is reported in many papers.
I don't know what the proliferation rate is like for the cells in the conditions of that study, but apparently up to 7 divisions in 4 days is considered plausible for T-cells: http://www.ncbi.nlm.nih.gov/pubmed/17367338
This is very easy. If you take a very many cells, some small percent will be mutants at any given site (unless you claim zero background rates of mutation, which is absurd and also directly contradicted by the data in these same papers). If you give a treatment that raises/causes the affinity of DNA damaging substances for a certain site, this will selectively damage the DNA of the non-mutant cells. The proliferation of the non-mutants will be suppressed and many will die off. The remaining mutants will proliferate to fill the gap. See my other post for a (very simple) mathematical model of this phenomenon.
This is not absurd at all. It is basic logic and algebra. I will check that paper and get back to you. I actually have not read any using bacterial cells yet, thanks. Also, as far as I know there are no mathematical models of the standard proposed CRISPR mechanism that have been published, if you know of one that would be great.
No one has to address alternative hypotheses that don't make any sense. Are you unaware that Sanger Sequencing exists, and the actual lesions can be read? Or that heterologous genes are being introduced with CRISPR methods? Neither of these common results can be explained by the spontaneous insertion of hundreds of nucleotides that happen to precisely match the sequence of the construct being inserted.
Again, this is utter nonsense and demonstrates a complete absence of basic understanding in molecular biology.
The first is just as consistent with the selection mechanism, because low levels of baseline mutants ARE reported (see the Schumann et al and Hendel et al papers I linked to in this thread for examples).
The second would indeed be difficult to explain with a selection mechanism, unfortunately I have not seen that actually published. Instead, the primers used can just as well be amplifying the template and/or the sequence of the inserted cassette is not shown (eg Figure 2D and S1 here: http://www.sciencemag.org/content/348/6233/442 )
If you have a reference to a specific paper I would appreciate it.
That is why I am asking others to provide their own references. The papers I have read do not seem capable of distinguishing between modification vs selection after careful inspection.
As with most science, this has taken a long time and been the result of work by many, many scientists. Some scientists have big egos and are fighting about who the "real genius" is. Furthermore, it's widely thought that there's going to be a lot of money in this technique, if you can get a patent on it.
TL;DR; cool and potentially very useful science happened, now big egos, big greed, and people who would rather get rich and win a Nobel prize than share the discovery and its benefits with the world are having a fight about it.
There is a patent dispute about who owns the patent on this technique. Lots of money is potentially at stake. This article was written from one of the parties (Broad institute and UC Berkely) being one of them. Oddly the Lander article supports the notion that this invention is evolution not revolutionary.
Broad has been working to move from from CRISPR/CAS9 to CRISPR/Something else better). The UC Berkley seems to have come up with it first, but is it obvious or obvious to use in editing is the question. The UC [2]team has pulled all there patent claims and resubmitted them twice, presumably to broaden the scope and cover any use. Add some east coast/west coast rivalry and some other biases and you have a powder keg of science.
Anyway lots of blame to go around.
siyer posted this in a previous article which puts the patent dispute in context and if the patent is only cas9:
[1]http://www.ipscell.com/2016/01/patent-expert-weighs-in-on-cr...
and the strange patent application by UC and :
[2]https://law.stanford.edu/2015/12/29/the-crispr-patent-interf...
There’s a patent issue too, but it’s difficult to evaluate since the issue is between a non-profit (The Broad Institute of MIT and Harvard) and a public institution (University of California, Berkley) and most people acknowledge that either would be better for progress than any commercial entity.
Is reconciliation possible? What would it take?
It's not. Your theory does not explain how site specific gene integration of transgenic products is possible if CRISPR/Cas is not an efficient site specific nuclease. If Cas9 is not cutting the DNA at the specific site so the transgenic product can integrate there, we wouldn't be getting the results seen.
Also, seeing what happens using template only would be good. We would expect low baseline levels of HDR to occur right? I it is plausible few out of 10^5 or 10^6 cells will require repair at that locus even without any Cas9.
> No one knows why the lawyers considered a patent application, but it seems likely that they would only have used it to prevent companies from making unlicensed, low-quality versions of the vaccine. There is no indication that the foundation intended to profit from a patent on the polio vaccine.
Why would the public be in an uproar about using patent protections to keep low-quality vaccines out of the market, while otherwise making the license available at no cost?
For one thing you don't need patent protections to keep 'low quality' vaccines out of the market. To my knowledge, that's what government regulatory bodies like the FDA are for.
> while otherwise making the license available at no cost?
Even if this was the case, I'm sure that Salk knew that if it was patented, that this would be only temporary (with no guarantees on reasonable pricing in the future); and it would be an unnecessary and immediate roadblock to helping people.
Not at all. I'm not sure you understand what I am saying.
It appears to me the data can be interpreted in multiple ways. Two different "theories" can explain the same results. This is a much more insidious problem than mere non-replication (I haven't seen any direct replications regarding CRISPR either though). People can continue on the wrong path for a long time by interpreting good, reliable data incorrectly.
Government funded research institutions will continue to provide BREAKTHROUGHS to receive funding.
That's an interesting one, because that cost is entirely caused by the government. The government could for example fund clinical trials, since they're the ones who are interested in it's results (as is by extension the public).
As for the rest, if the science were freely available without a patent from the scientists, companies could still spend money making it a therapy and making a profit by doing it better and more efficiently than their competitors, and they could still get a patent on their work.
We're talking about making the science patent free, not the product.
Most scientific breakthroughs throughout history were pursued due to simple curiosity or necessity, precisely because without an international framework of patent law "patents" and the pursuit of technology as intellectual property directly for financial gain was impossible.
The British for example attempted to control physical access to textile IP but Samuel Slater[1] memorized as much as he could and "exported it" along with himself to the Americas to reap a fortune.
Not in any paper on CRISPR I have read, in fact just the opposite: there are always low levels of mutants found in the controls (eg Schumann et al 2015 linked below). Please link to the papers that have lead you to make this claim.
As it was, the Cutter polio vaccine incident shows that making the vaccine was not easy.
> I'm sure that Salk knew ...
How are you sure? Is this discussed in his biography or autobiography? I see the topic is covered in Jane S. Smith's "Patent the Sun", but I haven't read it.
Other vaccines (or vaccine preparations) at the time were patented. Was your described behavior typical for them?
CTCATTAGGCACCCCAGGCTTTACA
CTCAGT------CCCAGGCTTTACA
Unless you want to argue that the un-incorporated DNA was also transmitted to the next generation, which honestly, is extremely unlikely.
EDIT: Let me look again at this paper later.
http://www.sciencedirect.com/science/article/pii/S0092867413...
So efficiency is inversely proportional to toxicity, they treated many more than 5-25 cells (the selection would occur at the level of the embryo), and there was only 1-10% rate of mutation detection. Also, they used "Superovulated female B6D2F1 mice". This procedure leads to chromosomal abnormalities and probably genetic instability so we would expect elevated presence of mutations at any given site: http://jhered.oxfordjournals.org/content/77/1/39.full.pdf
I'll have to look closer at the HDR aspect though (primers used, etc). But what may be going on that usually they detect the insertion via PCR: there is one primer to a sequence unique to the cassette and another upstream or downstream that should only be in the cells. Then the segment spanning the junction is amplified which supposedly is conclusive evidence of insertion at the correct location. The problem is you can get single primer amplification and also the homology arms required for HDR are likely to contain similar sequences to the "cell-only" primer. Eg: http://link.springer.com/protocol/10.1385%2F0-89603-258-2%3A...
Hwang et al 2013: "On the next day, injected embryos were inspected under stereoscope and were classified as dead, deformed or normal phenotypes. Only embryos that developed normally were assayed for target site mutations"
They don't seem to tell us how many embryos were injected. And that study does not appear to use any type of control group at all. AFAICT, that is exactly the type of study that is consistent with a selection effect.
Like, as reported by Doudna:
http://science.sciencemag.org/content/337/6096/816.short
"We show here that in a subset of these systems, the mature crRNA that is base-paired to trans-activating crRNA (tracrRNA) forms a two-RNA structure that directs the CRISPR-associated protein Cas9 to introduce double-stranded (ds) breaks in target DNA. At sites complementary to the crRNA-guide sequence, the Cas9 HNH nuclease domain cleaves the complementary strand, whereas the Cas9 RuvC-like domain cleaves the noncomplementary strand. The dual-tracrRNA:crRNA, when engineered as a single RNA chimera, also directs sequence-specific Cas9 dsDNA cleavage."
Which part of that mechanism do you doubt? It sounds like you doubt the dsDNA nuclease activity of Cas9. Why not just order a plasmid, some Cas9 + gdna, put them together and sanger sequence your products? If Cas9 isn't a site specific guided endonuclease you could prove it for $200.
Then again, supposedly shingles is caused by extragenomic Varicella-zoster DNA that is somehow stable for decades and can be passed on during pregnancy. I'm not sure I believe that though, and of course that is viral DNA.
Anyway, in that Ruan et al (2015) they claim to have detected exactly the expected sequence across the junction in at least a few cells. I can't think of any explanation for that data other than CRISPR working as advertised. However, they don't report in what percent of the cells this was observed.
Edit: I mean supposedly those exact sequences shown in figure S2 never physically existed before and now they do, exactly as predicted by the theory. That is strong evidence.
Not at all. This would be why the treatment is toxic and suppressive of proliferation.
At this point, I still think the presence of indels at the site (ie the proposed NHEJ mechanism) is just as easily explained by selection for pre-existing mutants. The experiments involving insertion of DNA (ie the proposed HDR mechanism) are better, but lack controls for "off-target" PCR amplification when showing the gels. IE we need to know how often the template itself will be amplified under their primers/conditions, both free and if it gets incorporated in some random location.
When segments across the insertion junction are amplified, sequenced, and reported, I find this convincing as it is a precise prediction that matches the data and I can think of no other explanation. The other experiments are pretty much redundant and add nothing. However, the reports I have seen contain little methodological or quantitative information regarding these sequences which does make me remain skeptical, especially about claims of efficiency. Those claims seem to always be determined using the former experiments that can be explained in other ways.
I can keep going, but would prefer you bring references of your own so I cannot be accused of cherry picking.
Please link to the data that you believe contradicts my proposed mechanism.